|
|
|
Registros recuperados: 26 | |
|
| |
|
|
Kibugu, J.K; Makumi, J.N; Ngeranwa, J.J.N; Kagira, J.M; Gathumbi, J.K; Mwangi, J.N. |
Aflatoxins are known to alter the pathogenesis of many infectious diseases, but such effects have not been evaluated in trypanosome infections. The aim of the present work was to assess the effects of aflatoxin B1 on the pathogenesis of Trypanosoma brucei rhodesiense infection using a murine model. Mice fed on 0.50 mg/kg aflatoxin b. wt. were infected with T. b. rhodesiense and compared to trypanosome infected and uninfected aflatoxin-fed controls. The clinical and pathological changes were determined and the quantitative data statistically analysed using standard methods. The results showed that infected aflatoxin-fed mice had pronounced dyspnoea, significantly (P<0.05) reduced survival, extreme emaciation, pronounced macrocytic normochromic anaemia... |
|
Palavras-chave: Aflatoxin B1; Trypanosomiasis; Pathogenesis; Mice. |
Ano: 2009 |
URL: http://ir.obihiro.ac.jp/dspace/handle/10322/2384 |
| |
|
| |
|
|
Paillard, Christine; Leroux, Frederique; Borrego, Juan. |
The main microbial diseases affecting marine cultured bivalves have been revised on the basis of the etiologic agents, pathogenesis and pathogenicity. Several recent bivalve-interaction models have been studied, including Pecten larvae-Vibrio pectinicida, brown ring disease, juvenile oyster disease, Pacific oyster nocardiosis and summer mortalities of oysters. In addition, the taxonomy and phylogeny of new potential bivalve pathogens and their virulence factors have been established. Facing the difficulty of identifying bacterial strains associated with molluscan diseases (mainly vibriosis), polyphasic approaches have been developed to correlate the phenotype and genotype of potential pathogens. By evaluating likely virulence mechanisms, developing... |
Tipo: Text |
Palavras-chave: Diagnostic tools; Virulence factors; Pathogenicity; Pathogenesis; Etiology; Bivalve mollusc; Vibriosis. |
Ano: 2004 |
URL: http://archimer.ifremer.fr/doc/2004/publication-407.pdf |
| |
|
| |
|
|
Labreuche, Yannick; Lambert, Christophe; Soudant, Philippe; Boulo, Viviane; Huvet, Arnaud; Nicolas, Jean-louis. |
The strategies used by bacterial pathogens to circumvent host defense mechanisms remain largely undefined in bivalve molluscs. In this study, we investigated experimentally the interactions between the Pacific oyster (Crassostrea gigas) immune system and Vibrio aestuarianus strain 01/32, a pathogenic bacterium originally isolated from moribund oysters. First, an antibiotic-resistant V. aestuarianus strain was used to demonstrate that only a limited number of bacterial cells was detected in the host circulatory system, suggesting that the bacteria may localize in some organs. Second, we examined the host defense responses to V. aestuarianus at the cellular and molecular levels, using flow-cytometry and real-time PCR techniques. We showed that hemocyte... |
Tipo: Text |
Palavras-chave: Crassostrea gigas; Oyster; Pathogenesis; Vibrio aestuarianus; Bivalve immunity. |
Ano: 2006 |
URL: http://archimer.ifremer.fr/doc/2006/publication-2182.pdf |
| |
|
| |
|
|
Gagnaire, Beatrice; Gay, Melanie; Huvet, Arnaud; Daniel, Jean-yves; Saulnier, Denis; Renault, Tristan. |
To assess the impact of pollution induced by pesticides on Pacific oyster, Crassostrea gigas, health in France, in vivo effects of combined pesticide exposure and bacterial challenge on cell activities and gene expression in hemocytes were tested using flow cytometry and real-time PCR. As a first step, an in vivo model of experimental contamination was developed. Pacific oysters were exposed to a mixture of eight pesticides (atrazine, glyphosate, alachlor, metolachlor, fosetyl-alumimium, terbuthylazine, diuron and carbaryl) at environmentally relevant concentrations over a 7-day period. Hemocyte parameters (cell mortality, enzyme activities and phagocytosis) were monitored using flow cytometry and gene expression was evaluated by real-time PCR (RT-PCR).... |
Tipo: Text |
Palavras-chave: Gene expression; Flow cytometry; Vibrio splendidus; Pathogenesis; Phagocytosis; Hemocyte; Pesticides; Bivalve immunity; Crassostrea gigas; Pacific oyster. |
Ano: 2007 |
URL: http://archimer.ifremer.fr/doc/2007/publication-3022.pdf |
| |
|
|
Xiong,H.; Yang,X.Y.; Han,J.; Wang,Q.; Zou,Z.L.. |
The purpose of this study was to explore cytokine expression patterns and cytogenetic abnormalities of mesenchymal stem cells (MSCs) from the bone marrow microenvironment of Chinese patients with myelodysplastic syndromes (MDS). Bone marrow samples were obtained from 30 cases of MDS (MDS group) and 30 healthy donors (control group). The expression pattern of cytokines was detected by customized protein array. The karyotypes of MSCs were analyzed using fluorescence in situ hybridization. Compared with the control group, leukemia inhibitory factor, stem cell factor (SCF), stromal cell-derived factor (SDF-1), bone morphogenetic protein 4, hematopoietic stem cell (HSC) stimulating factor, and transforming growth factor-β in the MDS group were significantly... |
Tipo: Info:eu-repo/semantics/article |
Palavras-chave: Bone marrow microenvironment; Cytokine; Mesenchymal stem cell; Chromosome; Pathogenesis. |
Ano: 2015 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000300207 |
| |
|
| |
|
|
Dang,N.N.; Pang,S.G.; Song,H.Y.; An,L.G.; Ma,X.L.. |
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5,... |
Tipo: Info:eu-repo/semantics/article |
Palavras-chave: Atopic dermatitis; T helper 2 cytokines; Filaggrin silencing; Pathogenesis. |
Ano: 2015 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000100039 |
| |
|
|
Appolinário,Camila; Allendorf,Susan Dora; Vicente,Acácia Ferreira; Ribeiro,Bruna Devidé; Fonseca,Clóvis Reinaldo da; Antunes,João Marcelo; Peres,Marina Gea; Kotait,Ivanete; Carrieri,Maria Luiza; Megid,Jane. |
ABSTRACTRabies virus (RABV) isolated from different mammals seems to have unique characteristics that influence the outcome of infection. RABV circulates in nature and is maintained by reservoirs that are responsible for the persistence of the disease for almost 4000 years. Considering the different pattern of pathogenicity of RABV strains in naturally and experimentally infected animals, the aim of this study was to analyze the characteristics of RABV variants isolated from the main Brazilian reservoirs, being related to a dog (variant 2),Desmodus rotundus (variant 3), crab eating fox, marmoset, and Myotis spp. Viral replication in brain tissue of experimentally infected mouse was evaluated by two laboratory techniques and the results were compared to... |
Tipo: Info:eu-repo/semantics/article |
Palavras-chave: Pathogenesis; QRT-PCR; FAT; Rabies; Variants. |
Ano: 2015 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1413-86702015000500479 |
| |
|
| |
|
|
Xu,H.; Ma,J.; Wu,J.; Chen,L.; Sun,F.; Qu,C.; Zheng,D.; Xu,S.. |
The present study screened potential genes related to lung adenocarcinoma, with the aim of further understanding disease pathogenesis. The GSE2514 dataset including 20 lung adenocarcinoma and 19 adjacent normal tissue samples from 10 patients with lung adenocarcinoma aged 45-73 years was downloaded from Gene Expression Omnibus. Differentially expressed genes (DEGs) between the two groups were screened using the t-test. Potential gene functions were predicted using functional and pathway enrichment analysis, and protein-protein interaction (PPI) networks obtained from the STRING database were constructed with Cytoscape. Module analysis of PPI networks was performed through MCODE in Cytoscape. In total, 535 upregulated and 465 downregulated DEGs were... |
Tipo: Info:eu-repo/semantics/article |
Palavras-chave: Lung adenocarcinoma; Pathogenesis; Differentially expressed genes; Protein-protein interaction; Network module. |
Ano: 2016 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2016000300601 |
| |
|
|
Brito,Cristiane Silveira; Ribas,Rosineide Marques; Resende,Daiane Silva; Brito,Denise Von Dolinger de; Abdallah,Vânia Olivetti Steffen; Santos,Kátia Regina Netto dos; Cavalcante,Fernanda Sampaio; Matos,Pricilla Dias Moura de; Gontijo Filho,Paulo P.. |
OBJECTIVE: To investigate the pathogenesis of bloodstream infection by Staphylococcus epidermidis, using the molecular epidemiology, in high-risk neonates. METHODS: We conducted a prospective study of a cohort of neonates with bloodstream infection using central venous catheters for more than 24 h. "National Healthcare Safety Network" surveillance was conducted. Genotyping was performed by DNA fingerprinting and mecA genes and icaAD were detected by multiplex-PCR. RESULTS: From April 2006 to April 2008, the incidence of bloodstream infection and central venous catheter-associated bloodstream infection was 15.1 and 13.0/1000 catheter days, respectively, with S. epidermidis accounting for 42.9% of episodes. Molecular analysis was used to document the... |
Tipo: Info:eu-repo/semantics/article |
Palavras-chave: Neonates; Central venous catheter; Pathogenesis. |
Ano: 2014 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1413-86702014000400387 |
| |
|
|
Lima,Carmen Silvia Passos; Néri,Iramaia Angélica; Lourenço,Gustavo Jacob; Faria,Isabel Cristina Jacinto; Ribeiro,José Dirceu; Bertuzzo,Carmen Silvia. |
Xenobiotics can trigger degranulation of eosinophils and mast cells. In this process, the cells release several substances leading to bronchial hyperactivity, the main feature of atopic asthma (AA). GSTM1 and GSTT1 genes encode enzymes involved in the inactivation of these compounds. Both genes are polymorphic in humans and have a null variant genotype in which both the gene and corresponding enzyme are absent. An increased risk for disease in individuals with the null GST genotypes is therefore, but this issue is controversial. The aim of this study was to investigate the influence of the GSTM1 and GSTT1 genotypes on the occurrence of AA, as well as on its clinical manifestations. Genomic DNA from 86 patients and 258 controls was analyzed by polymerase... |
Tipo: Info:eu-repo/semantics/article |
Palavras-chave: Atopic asthma; Pathogenesis; GSTM1 gene; GSTT1 gene. |
Ano: 2010 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1415-47572010000300007 |
| |
|
|
Pádua,Santiago Benites de; Martins,Maurício Laterça; Valladão,Gustavo Moraes Ramos; Utz,Laura; Zara,Fernando José; Ishikawa,Márcia Mayumi; Belo,Marco Antonio de Andrade. |
Abstract: The objective of this work was to describe the host-Epistylis sp. relationship during infestation on farmed fish. Five Nile tilapia (Oreochromis niloticus) and ten hybrid surubim catfish (Pseudoplatystoma reticulatum x P. corruscans), all diseased, were used for in vivo morphological analysis of sessile peritrichs by contrast microscopy. Fragments of infected tissues were subjected to histological processing and scanning electron microscopy. Epistylis sp. caused hemorrhagic ulcer disease, and cichlids were more prone to develop infestations throughout the body surface due to the attachment of the colonies to the scales, which did not occur with pimelodids. Multifocal granulomatous dermatitis was observed, associated with the hydropic degeneration... |
Tipo: Info:eu-repo/semantics/article |
Palavras-chave: Oreochromis niloticus; Pseudoplatystoma reticulatum; Pseudoplatystoma corruscans; Histopathology; Pathogenesis; Sessile peritrich.. |
Ano: 2016 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2016000500520 |
| |
|
|
Tiwari,Sarika; Singh,Rishi Kumar; Tiwari,Ruchi; Dhole,Tapan N.. |
Japanese encephalitis virus (JEV) causes Japanese encephalitis, which is a leading form of viral encephalitis in Asia, with around 50,000 cases and 10,000 deaths per year in children below 15 years of age. The JEV has shown a tendency to extend to other geographic regions. Case fatality averages 30% and a high percentage of the survivors are left with permanent neuropsychiatric sequelae. Currently, there is no cure for JEV, and treatment is mainly supportive. Patients are not infectious, but should avoid further mosquito bites. A number of antiviral agents have been investigated; however, none of these have convincingly been shown to improve the outcome of JEV. In this review, the current knowledge of the epidemiology and the pathogenesis of this deadly... |
Tipo: Info:eu-repo/semantics/article |
Palavras-chave: Epidemiology; Pathogenesis; Vector born diseases; Epidemics. |
Ano: 2012 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1413-86702012000600011 |
| |
|
|
Ferreira,Leonardo Cesar; Cataneo,Ana Catarina. |
Several studies were carried out in order to improve the knowledge about the occurrence and activity of nitric oxide (NO) in plants. Thus, this review discusses some aspects related to NO in plants such as chemical properties, synthesis pathways, physiological effects, antioxidant action, signal transduction, interaction with plant hormones and gene expression. In the last years, many advances have been obtained regarding NO synthesis and its physiological effects in plants. However, the molecular mechanisms underlying its effects remain poorly understood. It is signalized that tight interplays among NO, Ca2+, cyclic ADP ribose (cADPR), and protein kinases need to be investigated in details. In addition, it has not yet been possible to identify a plant... |
Tipo: Info:eu-repo/semantics/other |
Palavras-chave: Pathogenesis; Plant hormones; Plant signal transduction; Reactive oxygen species. |
Ano: 2010 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0103-90162010000200017 |
| |
|
|
Marks,Fernanda S.; Almeida,Laura L.; Driemeier,David; Canal,Cláudio; Barcellos,David E.S.N.; Guimarães,Jorge A.; Reck,José. |
Abstract Porcine circovirus type 2 (PCV2) is the primary causative agent of porcine circovirus disease, a complex multisystem syndrome in domestic pigs. Despite the significant economic losses caused by porcine circovirus disease, the mechanisms of pathogenesis underlying the clinical findings remain largely unclear. As various reports have highlighted the potential key role of vascular lesions in the pathogenesis of porcine circovirus disease, the aim of this work was to investigate effects of PCV2 infection on vascular endothelial cells, focusing on cell viability and expression of adhesion/junction molecules. PCV2 infection reduced endothelial cell viability, while viral infection did not affected the viability of several other classical cell lines.... |
Tipo: Info:eu-repo/semantics/article |
Palavras-chave: Swine; Infectious diseases; Pathogenesis; Viral infection; Cell adhesion. |
Ano: 2016 |
URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1517-83822016000400870 |
| |
Registros recuperados: 26 | |
|
|
|